The primer sequences for PCR detection of microcins B17, H47, J25, L, and V, respectively, were taken from previously published paper [26]. With the exception of microcin M, all bacteriocin genes detected in the study performed by Gordon and O’Brien [26] were analyzed in this work. Moreover, 12 additional bacteriocin genes were detected by us. PCR products resulting from detection of sequentially related colicin genes (colicins E2-E9, Ia-Ib, U-Y, and 5-10, respectively) were subjected to dideoxyterminator sequencing using amplification

primers. Because of sensitivity of microcin H47 to chloroform vapours, all investigated strains were tested for the presence of microcin H47-encoding genes. Sequence analysis was performed using Lasergene software (DNASTAR, P5091 ic50 Inc., Madison, WI). The phylogenetic group of each E. coli SB-715992 mw strain was determined using the triplex PCR protocol described previously [27]. Statistical analyses Statistical significance of the incidence Selleck SAR302503 of genotypes and colicin or microcin types, in both strain groups, was performed by applying standard methods derived from

the binomial distribution, including the two-tailed test. STATISTICA version 8.0 (StatSoft, Tulsa, OK, USA) was used for statistical calculations. Alternatively, an interactive calculation tool for chi-square tests of “”goodness of fit”" and independence was used for the calculation of statistical significance of obtained results [43]. Southern blot analyses and XL-PCR The total plasmid DNA of Monoiodotyrosine selected colicin producers were isolated using QIAprep Spin Miniprep Kit and QIAGEN Plasmid Midi Kit (Qiagen, Hilden, Germany), respectively. During isolation of plasmid DNA, manufacturer’s recommendations were followed. The plasmid DNA was digested with the EcoRI restriction endonuclease (New England Biolabs, Ipswitch, MA) and the undigested and digested total plasmid DNA was transferred to

the Hybond-XL membrane by a standard capillary method (Amersham, Buckinghamshire, UK). The colicin E1 and Ia probes used in Southern blot analysis were amplified from the control producer strains with primers used for detection of colicin genes (Additional file 1). The probes were labelled with the Gene Images AlkPhos Direct Labelling and Detection System (Amersham) and the labelled hybridized probes were detected with the ECF chemifluorescent substrate and the Typhoon imager (Amersham) according to the manufacturer’s recommendations. The GeneAmp® XL PCR Kit (Roche Molecular Systems, Branchburg, NJ, USA) was used for amplification of pColE1 plasmid DNA using pColE1-seq1 (5′ – GCCGATCGTGATGCTATTTT – 3′) and pColE1-seq2 (5′ – AAAATAGCATCACGATCGGC – 3′) complementary primers recognizing colicin E1 operon. Acknowledgements This work was supported by a grant from the Ministry of Health of the Czech Republic (NS9665-4/2008) to D.S.